REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, OCTOBER 20, 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406, 6310 WILHELMINA DELCO DR., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Padmini Jambulapati, Chair Alka Bhanot Sarah Xiyi Chen Hanna Huang Ahmed Moledina Alpha Shrestha Kuo Yang CALL TO ORDER Nirali Thakkar, Vice-Chair Sarah Chen Zachary Dolling Hugh Li Bhumika Purohit Nayer Sikder PUBLIC COMMUNICATION: GENERAL The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on September 15, 2026. DISCUSSION ITEMS 2. 3. Presentation by Yesterday’s Gone 501c3 regarding current work, programs and initiatives. Presented by Loree Tamayo, Executive Director, Yesterday’s Gone 501c3. Presentation by Asian Texans for Justice regarding trends in voting preferences and GOTV efforts. Presentation by Sarah Xiyi Chen, Commissioner, Asian American Quality of Life Advisory Commission. DISCUSSION AND ACTION ITEMS 4. Approve the 2027 annual schedule of the Asian American Quality of Life Advisory Commission. WORKING GROUP UPDATE 5. 6. 7. Update from Community Engagement Working Group regarding recent Community Engagement efforts. Update from the Asian American Resource Center working group regarding facility updates. Update from Joint Inclusion Committee regarding recent Austin Arts, Culture, Music, Entertainment presentation. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison or TTY users’ route through 711. A person may request language access accommodations no later than 48 hours before the scheduled meeting. Please call or email Chelsea Pfeifer at the Austin City Clerk’s Office, at 512-974-2498 or chelsea.pfeifer@austintexas.gov to request service or for additional …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, September 15, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, September 15, 2026 at the Permitting and Development Center, room #1406, 6310 Wilhelmina Delco Drive in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Nirali Thakkar, Vice Chair Hanna Huang COMMISSIONERS IN ATTENDANCE REMOTELY: Sarah Chen Sarah Xiyi Chen Zachary Dolling Hugh Li Nayer Sikder Bhumika Purohit PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on August 18, 2026. The minutes were approved with the following amendment: “The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, January August 18, 2026 at 301 W. 2nd Street in Austin, Texas the Permitting and Development Center, Room #1406, 6310 Wilhelmina Delco Drive, Austin TX.” ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, September 15, 2026 on Commissioner Huang’s motion, Vice Chair Thakkar’s second on an 8-0 vote. Commissioner Purohit was off the dais. Commissioners Moledina, Shrestha and Yang were absent. STAFF BRIEFINGS 2. 3. 4. Staff briefing regarding Varsity Generation Programming and Austin’s aging Asian American community. Presentation by Kelly Maltsberger, Assistant Director, Austin Parks and Recreation and Jesus Aguirre, Director, Austin Parks and Recreation. The presentation was made by Kelly Maltsberger, Assistant Director, Austin Parks and Recreation and Jesus Aguirre, Director, Austin Parks and Recreation. Staff briefing regarding facilities updates to the Asian American Resource Center (AARC). Presentation by Darrell Alexander, Director, Austin Facilities Management. The presentation was made by Darrell Alexander, Director, Austin Facilities Management. Staff briefing regarding the Creative Reset II Initiative and the AARC. Presented by Candice Cooper, Chief Administrative Officer, Austin Arts, Culture, Music and Entertainment. The presentation was made by Candice Cooper, Chief Administrative Officer, Austin Arts, Culture, Music and Entertainment (ACME), Matrix Kilgore, Division Manager, ACME, and Leila Grace Pandy, Supervisor of Culture and Arts Education, Austin Parks and Recreation. DISCUSSION AND ACTION ITEMS 5. 6. Approve a nomination of stakeholder member to the Asian American Quality of Life Advisory Commission. The motion to approve the nomination of stakeholder member Alka Bhanot was approved on Commissioner Huang’s motion, Vice Chair Thakkar’s second on a 9-0 vote. Commissioners …
Yesterday’s Gone Women’s Shelter A Place to Live | A Place to Heal YeYY sterday’s’ Gone ofo fff eff rsrr a one-year Yesterday’s Gone offers a one-year transitional housing program along trarr nsitional housingn progo rarr m alongn with resource coordination services for with resource coordination services foff r women, their children, and their pets. women,n their children,n and their petstt . yesterdaysgone.org The impact of Yesterday’s Gone’s programs in 2025 is seen in the research, TTTTTTTTThhhhhhhhheeeeeeee iiiiiiiimmmmmmmmpppppppppaaaaaaaaaccccccccttttttttt oooooooofffffffff YYYYYYYYYeeeeeeeessssssssttttttttteeeeeeeerrrrrrrrrdddddddddaaaaaaaayyyyyyyyy’’’’sssssss GGGGGGGGGoooooooonnnnnnnneeeeeeee’’’’sssssss ppppppppprrrrrrrrroooooooogggggggrrrrrrrrraaaaaaaammmmmmmmssssssss iiiiiiiinnnnnnnnn 22222222000000002222222255555555 iiiiiiiissssssss sssssssseeeeeeeeeeeeeeeennnnnnnnn iiiiiiiinnnnnnnn tttttttthhhhhhhhheeeeeeee rrrrrrrrreeeeeeeesssssssseeeeeeeeaaaaaaaarrrrrrrrrcccccccchhhhhhhhh,,,, goal documentation, surveys, and testimonies from the women that we serve. gggggggooooooooaaaaaaaallllllll dddddddddooooooooccccccccuuuuuuummmmmmmmeeeeeeeennnnnnnntttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn,,,, ssssssssuuuuuuurrrrrrrrrvvvvvvvvveeeeeeeeyyyyyyyyysssssss,,,, aaaaaaaannnnnnnnddddddddd ttttttttteeeeeeeesssssssstttttttttiiiiiiiimmmmmmmmoooooooonnnnnnnniiiiiiiieeeeeeeessssssss fffffffffrrrrrrrrrfff oooooooommmmmmmm tttttttthhhhhhhhheeeeeeee wwwwwwwwwoooooooommmmmmmmeeeeeeeennnnnnnn tttttttthhhhhhhhhaaaaaaaattttttttt wwwwwwwwweeeeeeee sssssssseeeeeeeerrrrrrrrrvvvvvvvvveeeeeeee.... 4,317 4,317 Saffee Nighttss ffor Women Safe Nights for Women & Their Childrreen & Their Children 1,431 1,431 Saffee Nighttss ffor Our Safe Nights for Our Guesttss’ Pettss Guests’ Pets The impact of Yesterday’s Gone’s programs in 2025 is seen in the research, TTTTTTTTThhhhhhhhheeeeeeee iiiiiiiimmmmmmmmpppppppppaaaaaaaaaccccccccttttttttt oooooooofffffffff YYYYYYYYYeeeeeeeessssssssttttttttteeeeeeeerrrrrrrrrdddddddddaaaaaaaayyyyyyyyy’’’’sssssss GGGGGGGGGoooooooonnnnnnnneeeeeeee’’’’sssssss ppppppppprrrrrrrrroooooooogggggggrrrrrrrrraaaaaaaammmmmmmmssssssss iiiiiiiinnnnnnnnn 22222222000000002222222255555555 iiiiiiiissssssss sssssssseeeeeeeeeeeeeeeennnnnnnnn iiiiiiiinnnnnnnn tttttttthhhhhhhhheeeeeeee rrrrrrrrreeeeeeeesssssssseeeeeeeeaaaaaaaarrrrrrrrrcccccccchhhhhhhhh,,,, goal documentation, surveys, and testimonies from the women that we serve. gggggggooooooooaaaaaaaallllllll dddddddddooooooooccccccccuuuuuuummmmmmmmeeeeeeeennnnnnnntttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn,,,, ssssssssuuuuuuurrrrrrrrrvvvvvvvvveeeeeeeeyyyyyyyyysssssss,,,, aaaaaaaannnnnnnnddddddddd ttttttttteeeeeeeesssssssstttttttttiiiiiiiimmmmmmmmoooooooonnnnnnnniiiiiiiieeeeeeeessssssss fffffffffrrrrrrrrrfff oooooooommmmmmmm tttttttthhhhhhhhheeeeeeee wwwwwwwwwoooooooommmmmmmmeeeeeeeennnnnnnn tttttttthhhhhhhhhaaaaaaaattttttttt wwwwwwwwweeeeeeee sssssssseeeeeeeerrrrrrrrrvvvvvvvvveeeeeeee.... Recorded Support Groups & Educational Programs; Recorded Support Groups & Educational Programs; Trauma-infoff rmed yoga, self-ff defeff nse, and lifeff skills sessions. Trauma-informed yoga, self-defense, and life skills sessions. 839 9 839 hrrss s hrs Recorded Lifeff Coach & Recorded Life Coach & Case Management sessions. Case Management sessions. 717 717 hrrss hrs Recorded Lifeff Coach & Recorded Life Coach & Counseling sessions foff r all Counseling sessions for all guests. guests. 271 271 hrrss hrs In 2025, Yesterday’s Gone guests reported improvements in the following areas: 44% 44% Anxiettyy Anxiety (GAD7) (GAD7) 50% 50% Deprreession Depression (PHQ9) (PHQ9) Our Programs Life Coach Life Skills Support Groups Education Our full-time Life Coach helps women manage emotions, build necessary life skills, and provides emotional support. Foundational life skills focused on financial stewardship, parenting support, effective time management and planning, and holistic mental and medical self- care. Our support groups offer a safe, healing space for women to share, reflect, and grow alongside others who understand their journey. Guests are also required to have a support system outside of our program. Supports women in earning a higher education, personal finance, and job readiness. Our Programs Employment Counseling Physical Health Spiritual Assistance in finding suitable employment, including résumé development and interview preparation. …
2027 Meeting Dates for Asian American Quality of Life Advisory Commission Location and Time TBD January 19 February 16 March 16 April 20 May 18 June 15 July 20 August 17 September 21 October 19 November 16 December 14
REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, SEPTEMBER 15, 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406, 6310 WILHELMINA DELCO DR., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Padmini Jambulapati, Chair Sarah Chen Zachary Dolling Hugh Li Bhumika Purohit Nayer Sikder CALL TO ORDER PUBLIC COMMUNICATION: GENERAL Nirali Thakkar, Vice-Chair Sarah Xiyi Chen Hanna Huang Ahmed Moledina Alpha Shrestha Kuo Yang The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on August 18, 2026. STAFF BRIEFINGS 2. 3. Staff briefing regarding Varsity Generation Programming and Austin’s aging Asian American community. Presentation by Kelly Maltsberger, Assistant Director, Austin Parks and Recreation and Jesus Aguirre, Director, Austin Parks and Recreation. Staff briefing regarding facilities updates to the Asian American Resource Center (AARC). Presentation by Darrell Alexander, Director, Austin Facilities Management. 4. Staff briefing regarding the Creative Reset II Initiative and the AARC. Presented by Candice Cooper, Chief Administrative Officer, Austin Arts, Culture, Music and Entertainment. DISCUSSION AND ACTION ITEMS 5. 6. Approve a nomination of stakeholder member to the Asian American Quality of Life Advisory Commission. Approve a nomination to the Joint Inclusion Committee. WORKING GROUP UPDATE 7. Update from Community Engagement Working group regarding community organizations, groups and companies representing or partnering with Asian American communities in Austin. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison or TTY users’ route through 711. A person may request language access accommodations no later than 48 hours before the scheduled meeting. Please call or …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, August 18, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, January 18, 2026, at 301 W. 2nd Street in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Alka Bhanot COMMISSIONERS IN ATTENDANCE REMOTELY: Nirali Thakkar, Vice Chair Aasiyah Baig Sarah Chen Bhumika Purohit Alpha Shrestha Nayer Sikder PUBLIC COMMUNICATION: GENERAL Jelina Tunstill- Community Advancement Network APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on July 16, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on July 16, 2026 were approved on Vice Chair Thakkar’s motion, Commissioner Chen’s second on a 9-0 vote. Commissioner Sikder was off the dais. Commissioners Dolling, Huang, Li and Yang were absent. DISCUSSION ITEMS 2. 3. Presentation by SAFE Alliance regarding public health services. Presented by Dani Fletcher, Senior Director of Marketing and Communications, SAFE Allliance. The presentation was made by Dani Fletcher, Senior Director of Marketing and Communications, SAFE Alliance. Presentation by Indie Meme regarding programming and partnership opportunities. Presented by Radhika Malhotra, Executive Director, Indie Meme. ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, August 18, 2026 The presentation was made by Radhika Malhotra, Executive Director, Indie Meme. 4. Discussion regarding the Lever of Economic Mobility Index reflection. Discussed. DISCUSSION AND ACTION ITEMS 5. Approve the creation of a working group regarding identifying engagement opportunities. The motion to approve the creation of a working group regarding identifying engagement opportunities was made by Vice Chair Thakkar, seconded by Commissioner Chen on a 10-0 vote. Commissioners Dolling, Huang, Li and Yang were absent. WORKING GROUP UPDATES 6. 7. Update from the AARC Working Group regarding updates from the last meeting. The update was given by Vice Chair Thakkar and Chair Jambulapati. Update from the Joint Inclusion Committee regarding sharing goals and focus areas. The update was given by Vice Chair Thakkar. FUTURE AGENDA ITEMS Approve an Alternate representative for the Joint Inclusion Committee. Presentation from Austin Parks and Recreation regarding Senior Programs serving the aging Asian American community. Presentation from Arts, Culture, Music and Entertainment regarding the Creative Reset. Chair Jambulapati adjourned the meeting at 7:20 p.m. without objection. 2
AFM-AACME Facility Management Facility Management, Building Services, and AARC Support September 2026 What sites from ACME has AFM acquired in the last year? Budgetary Changes & Staffing Transitioned Facilities Facility Operator Facility Manager Facility Name Site Added to AFM Management Portfolio Square Feet ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME ACME AFM Mexican American Cultural Center AFM Asian American Resource Center AFM Carver Museum AFM Carver Genealogy Center AFM Doughtery Arts Center AFM Millenium Youth Complex AFM African American Cultural Facility AFM Dedrick-Hamilton House AFM Montopolis Negro School AFM O Henery AFM Susanna Dickinson AFM Elisabet Ney AFM Zilker Hillside AFM Umlauf Museum AFM Old Bakery AFM Renaissance Artist Market AFM Conelly-Yerwood 1-Oct-25 1-Oct-25 1-Oct-25 1-Oct-25 1-Oct-25 1-Oct-25 1-Oct-25 1-Oct-25 1-Oct-26 1-Oct-26 1-Oct-26 1-Oct-26 1-Oct-26 1-Oct-26 1-Oct-26 1-Oct-26 1-Oct-26 56,241 11,700 36,000 1,890 24,600 55,000 5,100 1,114 2,750 1,327 1,935 4,000 7,250 8,000 7,480 NA 1,500 FY25-26 8 Facilities (including AARC) ~191,645 sq ft FY26-27 9 Facilities (As of Oct 1, 2026) ~34,242 sq ft ~225,887 Total Square Feet AARC comprises 5.18% of ACME’s total facility square footage 3 Transitioned Personnel ACME STAFFING BUDGET CURRENT STATUS 7.75 FTEs Transferred from APR to AFM in FY25 $632,224 Annual budget associated with transferred positions All Filled One position was vacant at the time of transition 6.00 FTEs Added to AFM via City Budget process in FY26 $530,382 Annual budget associated with positions All Filled 13.75 Total FTEs $1,162,606 Total ACME Personnel Budget Positions support services across ACME facilities No transferred or additional FTEs are dedicated exclusively to AARC. 4 Transition Costs through 2026 Expenses were primarily supported by the Facilities Management Fund, with select purchases funded through the Support Services Fund. $0 in operational funds were received during the transition. ACME PORTFOLIO AARC FACILITY AARC SHARE ~ $705,100 Spent/ Encumbered ~$127,120 Spent/ Encumbered ~19% of ACME Total AARC SPECIFIC FACILITY EXPENSES HVAC PLUMBING SECURITY EQUIPMENT $92,804.00 (Leak, Compressor, Condensers, ballroom issues, VRF, Coolers) $22,914.26 (Water Main Leak, Water Heater) $13,601.00 (Entech Sales & System Service) 5 Upcoming FY27 Budget $2,300,304 Total ACME Budget $104,918 Dedicated AARC Expense $87,000 Planned AARC Budget ~3.8% of AFM budget for AARC One-time Expense Covers: Audiovisual equipment Budget Covers: Personnel Contracted Goods & Services Utilities Does not include: HVAC PMs Landscaping Carpet Replacement 6 What facility and management services does AFM provide? Services & Site Coordination …
The Creative Reset Phase II Reimagining Austin’s Cultural Facilities and Museums Arts, Culture, Music, and Entertainment July 2026 Why Now? Austin Has Changed. Our Cultural System Must Change With It. ▪ Austin's population continues to grow and diversify. ▪ Community expectations have shifted from simply preserving facilities to actively programming and activating them. ▪ Residents expect welcoming, accessible, vibrant public spaces that are open, responsive, and community-centered. ▪ The Creative Reset presented an opportunity to rethink how our facilities operate, not just maintain the status quo. Emma S Barrientos Mexican American Cultural Center 2 Our Community Spaces Cultural Centers and Entertainment Complex Millennium Youth Entertainment Complex African American Cultural & Heritage Facility + Dedrick Hamilton House Asian American Resource Center Connelly-Yerwood “Pink” House Emma S Barrientos Mexican American Cultural Center George Washington Carver Museum, Cultural + Genealogy Center Museums and Art Center Montopolis Negro School Zilker Hillside Theater Dougherty Arts Center Elisabet Ney Museum UMLAUF Sculpture Garden & Museum Susanna Dickinson Museum O. Henry Museum Old Bakery & Emporium 23rd Street Renaissance Artist Market 3 Our Approach The Creative Reset Phase II Reimagining Austin’s Cultural Facilities and Museums Beverly Sheffield Hillside Theater Our Approach We designed this process around listening. Community Engagement Internal Assessment Staff Visioning Site Identity Exercise Operational Review Recommendations Implementation Plan Evaluation 5 Nearly a year of engagement ensured that our recommendations reflect both community priorities and operational realities. Elisabeth Ney Museum 6 Community: What We Heard The Creative Reset Phase II Reimagining Austin’s Cultural Facilities and Museums ACME Creative Reset Engagement Community: What We Heard Activate our facilities More activity, more energy, more opportunities. Expand partnerships Collaborate with artists, nonprofits, schools, and community organizations. Improve customer experience Create welcoming, consistent, easy-to-access spaces. Reduce barriers Simplify processes and increase accessibility. Celebrate each site's unique identity Honor history while creating new opportunities. Brush Square Pun-Off Event 8 Staff: What We Learned The Creative Reset Phase II Reimagining Austin’s Cultural Facilities and Museums Dougherty Arts Center Staff: What We Learned ▪ Staff are passionate and deeply committed to serving the community. ▪ Operational processes vary significantly across facilities. ▪ Administrative responsibilities often limit time available for programming and community engagement. ▪ Greater collaboration, shared services, and consistent expectations can improve efficiency while preserving each site's unique identity. ▪ Our facilities are aging. Staff Engagement Event 10 Our New Operating Model The Creative Reset Phase II Reimagining Austin’s Cultural Facilities …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, September 15, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, September 15, 2026 at the Permitting and Development Center, room #1406, 6310 Wilhelmina Delco Drive in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Nirali Thakkar, Vice Chair Hanna Huang COMMISSIONERS IN ATTENDANCE REMOTELY: Sarah Chen Sarah Xiyi Chen Zachary Dolling Hugh Li Nayer Sikder Bhumika Purohit PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on August 18, 2026. The minutes were approved with the following amendment: “The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, January August 18, 2026 at 301 W. 2nd Street in Austin, Texas the Permitting and Development Center, Room #1406, 6310 Wilhelmina Delco Drive, Austin TX.” ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, September 15, 2026 on Commissioner Huang’s motion, Vice Chair Thakkar’s second on an 8-0 vote. Commissioner Purohit was off the dais. Commissioners Moledina, Shrestha and Yang were absent. STAFF BRIEFINGS 2. 3. 4. Staff briefing regarding Varsity Generation Programming and Austin’s aging Asian American community. Presentation by Kelly Maltsberger, Assistant Director, Austin Parks and Recreation and Jesus Aguirre, Director, Austin Parks and Recreation. The presentation was made by Kelly Maltsberger, Assistant Director, Austin Parks and Recreation and Jesus Aguirre, Director, Austin Parks and Recreation. Staff briefing regarding facilities updates to the Asian American Resource Center (AARC). Presentation by Darrell Alexander, Director, Austin Facilities Management. The presentation was made by Darrell Alexander, Director, Austin Facilities Management. Staff briefing regarding the Creative Reset II Initiative and the AARC. Presented by Candice Cooper, Chief Administrative Officer, Austin Arts, Culture, Music and Entertainment. The presentation was made by Candice Cooper, Chief Administrative Officer, Austin Arts, Culture, Music and Entertainment (ACME), Matrex Kilgore, Division Manager, ACME, and Leila Grace Pandy, Supervisor of Culture and Arts Education, Austin Parks and Recreation. DISCUSSION AND ACTION ITEMS 5. 6. Approve a nomination of stakeholder member to the Asian American Quality of Life Advisory Commission. The motion to approve the nomination of stakeholder member Alka Bhanot was approved on Commissioner Huang’s motion, Vice Chair Thakkar’s second on a 9-0 vote. Commissioners …
REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, AUGUST 18, 2026 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406, 6310 WILHELMINA DELCO DR., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Padmini Jambulapati, Chair Aasiyah Baig Sarah Chen Zachary Dolling Hugh Li Bhumika Purohit Nayer Sikder CALL TO ORDER Nirali Thakkar, Vice-Chair Alka Bhanot Sarah Xiyi Chen Hanna Huang Ahmed Moledina Alpha Shrestha Kuo Yang PUBLIC COMMUNICATION: GENERAL The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on July 16, 2026. DISCUSSION ITEMS 2. 3. 4. Presentation by SAFE Alliance regarding public health services. Presented by Dani Fletcher, Senior Director of Marketing and Communications, SAFE Alliance. Presentation by Indie Meme regarding programming and partnership opportunities. Presented by Radhika Malhotra, Executive Director, Indie Meme. Discussion regarding the Lever of Economic Mobility Index reflection. DISCUSSION AND ACTION ITEMS 5. Approve the creation of a working group regarding identifying engagement opportunities. WORKING GROUP UPDATE 6. 7. Update from the AARC Working Group regarding updates from the last meeting. Update from the Joint Inclusion Committee regarding sharing goals and focus areas. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison or TTY users’ route through 711. A person may request language access accommodations no later than 48 hours before the scheduled meeting. Please call or email Chelsea Pfeifer at the Austin City Clerk’s Office, at 512-974-2498 or chelsea.pfeifer@austintexas.gov to request service or for additional information. For more information on the Asian American Quality of Life Advisory Commission …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, July 21, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, July 21, 2026 at the Permitting and Development Center, Room #1406, 6310 Wilhelmina Delco Drive in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:03 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Nirali Thakkar, Vice Chair Alka Bhanot Hanna Huang Ahmed Moledina Kuo Yang COMMISSIONERS IN ATTENDANCE REMOTELY: Aasiyah Baig Sarah Chen Zachary Dolling Hugh Li Alpha Shrestha Nayer Sikder PUBLIC COMMUNICATION: GENERAL None Present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on June 16, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on June 16, 2026 were approved on Vice Chair Thakkar’s motion, Commissioner Moledina’s second on a 10- 0 vote. Commissioners Bhanot and Yang were off the dais. Commissioners Purohit and Xiyi Chen were absent. STAFF BRIEFINGS 3. Staff briefing regarding Levers or Economic Mobility Index Update. Presentation by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion. ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, July 21, 2026 2. 4. The presentation was made by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion and Shivani Datar, Business Process Specialist, Austin Equity and Inclusion. Staff briefing regarding the Human Rights Impact report. Presentation by Dr. Lindsey Wilson, Director, Austin Equity and Inclusion, Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. The presentation was made by Dr. Lindsey Wilson, Director, Austin Equity and Inclusion and Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. Staff briefing regarding an Asian American Resource Center RFQ for Arts In Public Places. Presented by Jamie Castillo, Manager, Arts In Public Places (AIPP), Austin Arts, Culture, Music and Entertainment (ACME), Lindsey Hutchens, AIPP Coordinator, ACME. The presentation was made by Jamie Castillo, Manager, Arts In Public Places (AIPP), Austin Arts, Culture, Music and Entertainment (ACME), Lindsey Hutchens, AIPP Coordinator, ACME. DISCUSSION ITEMS 5. 6. Discussion regarding debrief of meeting with City Manager regarding Asian American Resource Center unmet needs. Discussed. Discussion of Annual Internal Review Report and Commission Priorities. Discussed. DISCUSSION AND ACTION ITEMS 7. 8. Approve a recommendation to Council regarding Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, August 18, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, August 18, 2026 at the Permitting and Development Center, Room #1406, 6310 Wilhelmina Delco Drive, Austin TX. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Alka Bhanot COMMISSIONERS IN ATTENDANCE REMOTELY: Nirali Thakkar, Vice Chair Aasiyah Baig Sarah Chen Bhumika Purohit Alpha Shrestha Nayer Sikder PUBLIC COMMUNICATION: GENERAL Jelina Tunstill- Community Advancement Network APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on July 16, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on July 16, 2026 were approved on Vice Chair Thakkar’s motion, Commissioner Chen’s second on a 9-0 vote. Commissioner Sikder was off the dais. Commissioners Dolling, Huang, Li and Yang were absent. DISCUSSION ITEMS 2. 3. Presentation by SAFE Alliance regarding public health services. Presented by Dani Fletcher, Senior Director of Marketing and Communications, SAFE Alliance. The presentation was made by Dani Fletcher, Senior Director of Marketing and Communications, SAFE Alliance. Presentation by Indie Meme regarding programming and partnership opportunities. Presented by Radhika Malhotra, Executive Director, Indie Meme. ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, August 18, 2026 The presentation was made by Radhika Malhotra, Executive Director, Indie Meme. 4. Discussion regarding the Lever of Economic Mobility Index reflection. Discussed. DISCUSSION AND ACTION ITEMS 5. Approve the creation of a working group regarding identifying engagement opportunities. The motion to approve the creation of a working group regarding identifying engagement opportunities was made by Vice Chair Thakkar, seconded by Commissioner Chen on a 10-0 vote. Commissioners Dolling, Huang, Li and Yang were absent. WORKING GROUP UPDATES 6. 7. Update from the AARC Working Group regarding updates from the last meeting. The update was given by Vice Chair Thakkar and Chair Jambulapati. Update from the Joint Inclusion Committee regarding sharing goals and focus areas. The update was given by Vice Chair Thakkar. FUTURE AGENDA ITEMS Approve an Alternate representative for the Joint Inclusion Committee. Presentation from Austin Parks and Recreation regarding Senior Programs serving the aging Asian American community. Presentation from Arts, Culture, Music and Entertainment regarding the Creative Reset. Chair Jambulapati adjourned the meeting at 7:20 …
REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, JULY 21, 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406, 6310 WILHELMINA DELCO DR., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Padmini Jambulapati, Chair Aasiyah Baig Sarah Chen Zachary Dolling Hugh Li Bhumika Purohit Nayer Sikder CALL TO ORDER Nirali Thakkar, Vice-Chair Alka Bhanot Sarah Xiyi Chen Hanna Huang Ahmed Moledina Alpha Shrestha Kuo Yang PUBLIC COMMUNICATION: GENERAL The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on June 16, 2026. STAFF BRIEFINGS 2. 3. Staff briefing regarding the Austin Human Rights Impact report. Presentation by Dr. Lindsey Wilson, Director, Austin Equity and Inclusion, Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. Staff briefing regarding Levers of Economic Mobility Index Update. Presentation by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion. 4. Staff briefing regarding an Asian American Resource Center RFQ for Arts In Public Places. Presented by Jamie Castillo, Manager, Art In Public Places (AIPP), Austin Arts, Culture, Music, and Entertainment (ACME), Lindsay Hutchens, AIPP Coordinator, ACME. DISCUSSION ITEMS 2. 3. Discussion regarding debrief of meeting with City Manager regarding Asian American Resource Center unmet needs. Discussion of Annual Internal Review Report and Commission Priorities. DISCUSSION AND ACTION ITEMS 4. 5. Approve a recommendation to Council regarding Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. Approve the creation of a Budget working group. WORKING GROUP UPDATE 6. Update from AARC working group regarding updates from the July workgroup meeting. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, June 16, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, June 16, 2026, at the Permitting and Development Center, 6310 Wilhelmina Delco Drive, Austin, TX. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Hanna Huang COMMISSIONERS IN ATTENDANCE REMOTELY: Sarah Chen Zachary Dolling Ahmed Moledina Bhumika Purohit Alpha Shrestha Nayer Sikder Sarah Xiyi Chen PUBLIC COMMUNICATION: GENERAL None Present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on May 19, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on May 19. 2026 were approved on Commissioner Moledina’s motion, Commissioner Huang’s second on an 8-0 vote. Commissioner Dolling was off the dais. Vice Chair Thakkar and Commissioners Baig, Bhanot, Li and Yang were absent. STAFF BRIEFINGS 2. Staff briefing regarding recent study and ongoing engagement with aging Asian American community in Austin. Presentation by Halana Kaleel, Public Health Community Engagement Specialist, Austin Public Health. The presentation was made by Halana Kaleel, Public Health Community Engagement Specialist, Austin Public Health. ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, June 16, 2026 DISCUSSION ITEMS 3. 4. Discussion regarding debrief of meeting with City Manager regarding Asian American Resource Center unmet needs. Discussed. The meeting with the City Manager has been rescheduled for July. Discussion regarding Annual Internal Review and Report. Discussed. DISCUSSION AND ACTION ITEMS 5. 6. 7. Approve a recommendation to Council regarding Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. Withdrawn without objection, due to needing more information from staff. Approve a recommendation to Council regarding funding for SAFE Alliance. The motion to approve a recommendation to Council regarding funding for SAFE Alliance failed on Commissioner Purohit’s motion, Commissioner Shrestha’s second on a 7-1-1 vote. Commissioner Moledina voted no. Commissioner Sikder abstained. Vice Chair Thakkar and Commissioners Baig, Bhanot, Li and Yang were absent. Approve the creation of a working group to identify needs of the Asian American Resource Center. The motion to approve the creation of a working group to identify needs of the Asian American Resource Center was approved on Commissioner Huang’s motion, Commissioner Chen’s second on a 9-0 vote. Vice Chair Thakkar and …
Mayor s Committee for People with Disabilities Human Rights Impact Review Austin Equity and Inclusion Asian American Quality of Life Advisory Commission Tuesday, July 21, 2026, 6:00 PM (PDC) What is a Human Rights Framework? A huma n right s fra me work e va lua t e s gove rnme nt pe rforma nc e t hrough t he le ns of residents’ rights, dignity, a nd equitable access to services. Ra t he r t ha n a s king whe t he r progra ms e xis t , it a s ks whe t he r pe ople 's right s a re be ing fulfille d a nd whe re barriers re ma in. Why is it necessary and how does it support the City? Policies and services can exist without reaching those who need them most. A human rights framework helps identify gaps, improve accountability, and ensure that city decisions advance dignity, equity, and access for all residents. 2 Co-Created Impact Review The City engaged He ne kom Group, a huma n right s c ons ult ing firm, t o c onduc t a n inde pe nde nt Huma n Right s Impa c t Re vie w. The re vie w inc lude d re s e a rc h a c ros s 160+ sources , e nga ge me nt wit h more t ha n 300 stakeholders , a nd a c ommunit y works hop wit h 120 participants priorit ize huma n right s ris ks a nd t o ide nt ify a nd opport unit ie s a c ros s 12 ke y is s ue a re a s . The re s ult ing re c omme nda t ions we re c o- c re a t e d, re fle c t ing c ommunit y input a nd be s t pra c t ic e from int e rna t iona l huma n right s s t a nda rds . 3 City of Austin - Human Rights Framework "Design and implement a Human Rights framework for assessing existing City services and programs to improve accessibility and responsiveness for residents' needs." 160+ 300+ Sources and commissions reviewed Stakeholders identified and engaged 120 Registered workshop attendees 92 Issues identified 69 Propos e d mit iga t ion …
Art in Public Places Public Art Calls Open June 22, 2026 Close August 3, 2026 Arts, Culture, Music and Entertainment AIPP Team Top row • Melissa Alvarado, Cultural & Heritage Tourism Division Manager • Lindsay Hutchens, AIPP Coordinator • Bryana Iglesias, AIPP Coordinator • Ryan Runcie, AIPP Coordinator Second row • Alex Irrera, AIPP Coordinator Sr • Rebecca Rende, AIPP Coordinator Sr • Ileana Yordan-Cuevas, AIPP Coordinator Sr • Frederico Salles Forte, AIPP Coordinator Sr Third row • Sean Harrison, AIPP Coordinator Sr (Collection Manager) • • Jieun Beth Kim, AIPP Coordinator (not shown) Brittany Heinchon, Culture & Arts Education Coordinator Jaime Castillo, AIPP Manager • 2 AIPP Process 1. SCOPING 2. SELECTING 3. DESIGNING 4. IMPLEMENTING 5. ARCHIVING a. Project Set Up a. Artist Selection a. Artist Research (30%) a. Construction Drawing a. Close Out b. Art Call b. Approval: Artist b. Concept (60%) b. Artwork Fabrication b. Intake c. Approval: Art Call c. Artist Contract c. Final (90%) c. Artwork Installation c. Maintenance Repair/Restoration 3 AIPP Process Community (stakeholders, AIPP Panel, Arts Commission) 1. SCOPING 2. SELECTING 3. DESIGNING 4. IMPLEMENTING 5. ARCHIVING a. Project Set Up a. Artist Selection a. Artist Research (30%) a. Construction Drawing a. Close Out b. Art Call b. Approval: Artist b. Concept (60%) b. Artwork Fabrication b. Intake c. Approval: Art Call c. Artist Contract c. Final (90%) c. Artwork Installation c. Maintenance Repair/Restoration 4 4 Open Calls • Asian American Resource Center: Artwork budget: $90,000 • Shared Streets: Artwork budget: $170,000 x3 • Northeast Service Center- Suspended Artwork: Artwork budget: $300,000 • 2026 Pre-Qualified Texas Public Artist Pool: Artwork budget: between $10,000 and $250,000+ 5 Standard Project Goals & Process 1. A work of art of redeeming quality that advances public understanding of visual art and enhances the aesthetic quality of public places 2. Conceptualizes a strong overall artwork design approach that integrates with the site and surrounding natural environment 3. 4. Is easily maintained and vandal resistant in an exterior environment Is permanent with an expected life span of at least 20 years Eligibility • Austin-based visual artists in the seven counties bounding the Austin metro area (Travis, Hays, Williamson, Bastrop, Caldwell, Burnet, and Blanco) • at least 18 years of age • Experience creating permanent artwork in materials suitable for the outdoors Selection Criteria • Artistic merit, creative capacity, technical expertise of past work • Enthusiasm and ability in …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, July 21, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, July 21, 2026 at the Permitting and Development Center, Room #1406, 6310 Wilhelmina Delco Drive in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:03 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Nirali Thakkar, Vice Chair Alka Bhanot Hanna Huang Ahmed Moledina Kuo Yang COMMISSIONERS IN ATTENDANCE REMOTELY: Aasiyah Baig Sarah Chen Zachary Dolling Hugh Li Alpha Shrestha Nayer Sikder PUBLIC COMMUNICATION: GENERAL None Present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on June 16, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on June 16, 2026 were approved on Vice Chair Thakkar’s motion, Commissioner Moledina’s second on a 10-0 vote. Commissioners Bhanot and Yang were off the dais. Commissioners Purohit and Xiyi Chen were absent. ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, July 21, 2026 STAFF BRIEFINGS 3. 2. 4. Staff briefing regarding Levers or Economic Mobility Index Update. Presentation by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion. The presentation was made by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion and Shivani Datar, Business Process Specialist, Austin Equity and Inclusion. Staff briefing regarding the Human Rights Impact report. Presentation by Dr. Lindsey Wilson, Director, Austin Equity and Inclusion, Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. The presentation was made by Dr. Lindsey Wilson, Director, Austin Equity and Inclusion and Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. Staff briefing regarding an Asian American Resource Center RFQ for Arts In Public Places. Presented by Jamie Castillo, Manager, Arts In Public Places (AIPP), Austin Arts, Culture, Music and Entertainment (ACME), Lindsey Hutchens, AIPP Coordinator, ACME. The presentation was made by Jamie Castillo, Manager, Arts In Public Places (AIPP), Austin Arts, Culture, Music and Entertainment (ACME), Lindsey Hutchens, AIPP Coordinator, ACME. DISCUSSION ITEMS 5. 6. Discussion regarding debrief of meeting with City Manager regarding Asian American Resource Center unmet needs. Discussed. Discussion of Annual Internal Review Report and Commission Priorities. Discussed. DISCUSSION AND ACTION ITEMS 7. 8. Approve a recommendation to Council regarding Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. Withdrawn …
REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, JUNE 16, 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406, 6310 WILHELMINA DELCO DR., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Padmini Jambulapati, Chair Aasiyah Baig Sarah Chen Zachary Dolling Hugh Li Bhumika Purohit Nayer Sikder CALL TO ORDER Nirali Thakkar, Vice-Chair Alka Bhanot Sarah Xiyi Chen Hanna Huang Ahmed Moledina Alpha Shrestha Kuo Yang PUBLIC COMMUNICATION: GENERAL The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on May 19, 2026. STAFF BRIEFINGS 2. Staff briefing regarding recent study and ongoing engagement with aging Asian American community in Austin. Presentation by Halana Kaleel, Public Health Community Engagement Specialist, Austin Public Health. DISCUSSION ITEMS 3. 4. Discussion regarding debrief of meeting with City Manager regarding Asian American Resource Center unmet needs. Discussion regarding Annual Internal Review and Report. DISCUSSION AND ACTION ITEMS 5. 6. 7. Approve a recommendation to Council regarding Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. Approve a recommendation to Council regarding funding for SAFE Alliance. Approve the creation of a working group to identify needs of the Asian American Resource Center. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison or TTY users’ route through 711. A person may request language access accommodations no later than 48 hours before the scheduled meeting. Please call or email Chelsea Pfeifer at the Austin City Clerk’s Office, at 512-974-2498 or chelsea.pfeifer@austintexas.gov to request service or for additional information. For more information …
ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, May 19, 2026 Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, May 19, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, May 19, 2026, at 4815 Mueller Blvd, Room 1125 in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:06 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Nirali Thakkar, Vice Chair Zachary Dolling COMMISSIONERS IN ATTENDANCE REMOTELY: Alka Bhanot Sarah Chen Hugh Li Ahmed Moledina Alpha Shrestha Nayer Sikder Sarah Xiyi Chen Kuo Yang PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on April 22, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on April 22, 2026 were approved on Vice Chair Thakkar’s motion, Commissioner Moledina’s second on a 9-0 vote. Commissioners Yang and Li were off the dais. Commissioners Baig and Huang were absent. DISCUSSION ITEMS ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, May 19, 2026 3. Discussion of Fiscal Year 2027 Priorities to inform future working groups. Discussed. DISCUSSION AND ACTION ITEMS 3. 4. Approve a recommendation to Council for Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. This item was withdrawn without objection. Approve a recommendation to Council regarding funding for Communities in Schools. This item was withdrawn without objection. FUTURE AGENDA ITEMS Recommendation to Council regarding ACME Market Review Recommendation to Council regarding Communities In Schools Staff Briefing from the APH Age-Friendly team on the recent study and ongoing engagement Staff Briefing from Austin Equity and Inclusion regarding the Levers of Economic Mobility Update Creation of Working Groups around recently discussed commission priorities Chair Jambulapati adjourned the meeting at 7:25 p.m. without objection. 2
RECOMMENDATION TO COUNCIL Asian American Quality of Life Advisory Commission Recommendation Number: [YYYYMMDD-XXX]: Emergency Budget Recommendation for SAFE Alliance - Eloise House Date of Approval: Recommendation: The Asian American Quality of Life Advisory Commission recommends that the Austin City Council and the Mayor’s Office, in partnership with Travis County allocate a minimum of $430,000 in funding to preserve Eloise House as a community-based, non-hospital forensic exam and advocacy center operated by SAFE Alliance from June 9 through September 30, 2026, and $200,000 to keep the SAFE domestic violence shelter open from October 2026 through October 2027. The Commission further recommends that the City commit to a sustainable, multi-year funding strategy that ensures continuity of SAFE’s full wraparound model without displacement into hospital settings. Services include: • Forensic exams • Trauma-informed advocacy • Shelter • Legal services • Culturally responsive care Finally, the Commission calls on the Austin City Council to immediately pause the Mayor’s proposed transition of forensic nursing services to hospital systems and BRAVE Alliance, and to require a meaningful community input process that centers survivors, advocates, and the communities most impacted before any transition moves forward. A press release is not a plan. Survivors and the organizations that serve them deserve a seat at the table before services that took decades to build are dismantled in weeks. Description of Recommendation to Council: Eloise House, operated by SAFE Alliance, is the only non-hospital forensic exam facility in Austin. It provides sexual assault forensic exams and rape kits at no cost to survivors, in a setting purporse built for: • Trauma-informed care • Outside the emergency room • Free from billing • Staffed by advocates who remain with survivors throughout the process The Mayor’s May 5, 2026 announcement proposed transitioning forensic nursing services to hospital systems and BRAVE Alliance, a Cedar Park-based organization with no demonstrated capacity at Austin’s scale. This Commission asks Council to reject that transition and instead fund Eloise House directly, preserving the co-located model of exam, advocacy, and wraparound care that has made it the destination of choice for survivors; accounting for 95% of all forensic exams in the region. Funding of at least $630,000 would allow SAFE to sustain approximately 600 forensic exams annually, maintain 24/7 SAFEline access, and continue serving the more than 700 survivors per day who rely on SAFE’s shelter, counseling, legal support, and preservation programming. SAFE Alliance - Eloise House Statistics …
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, June 16, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, June 16, 2026, at the Permitting and Development Center, 6310 Wilhelmina Delco Drive, Austin, TX. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Hanna Huang COMMISSIONERS IN ATTENDANCE REMOTELY: Sarah Chen Zachary Dolling Ahmed Moledina Bhumika Purohit Alpha Shrestha Nayer Sikder Sarah Xiyi Chen PUBLIC COMMUNICATION: GENERAL None Present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on May 19, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on May 19. 2026 were approved on Commissioner Moledina’s motion, Commissioner Huang’s second on an 8-0 vote. Commissioner Dolling was off the dais. Vice Chair Thakkar and Commissioners Baig, Bhanot, Li and Yang were absent. STAFF BRIEFINGS 2. Staff briefing regarding recent study and ongoing engagement with aging Asian American community in Austin. Presentation by Halana Kaleel, Public Health Community Engagement Specialist, Austin Public Health. The presentation was made by Halana Kaleel, Public Health Community Engagement Specialist, Austin Public Health. ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, June 16, 2026 DISCUSSION ITEMS 3. 4. Discussion regarding debrief of meeting with City Manager regarding Asian American Resource Center unmet needs. Discussed. The meeting with the City Manager has been rescheduled for July. Discussion regarding Annual Internal Review and Report. Discussed. DISCUSSION AND ACTION ITEMS 5. 6. 7. Approve a recommendation to Council regarding Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. Withdrawn without objection, due to needing more information from staff. Approve a recommendation to Council regarding funding for SAFE Alliance. The motion to approve a recommendation to Council regarding funding for SAFE Alliance failed on Commissioner Purohit’s motion, Commissioner Shrestha’s second on a 7-1 vote. Commissioner Moledina voted no. Commissioner Sikder abstained. Vice Chair Thakkar and Commissioners Baig, Bhanot, Li and Yang were absent. Approve the creation of a working group to identify needs of the Asian American Resource Center. The motion to approve the creation of a working group to identify needs of the Asian American Resource Center was approved on Commissioner Huang’s motion, Commissioner Chen’s second on a 9-0 vote. Vice Chair Thakkar and …
REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, MAY 19, 6:00 PM AUSTIN ENERGY HEADQUARTERS, ROOM 1125, 4815 MUELLER BLVD., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Padmini Jambulapati, Chair Aasiyah Baig Sarah Xiyi Chen Hanna Huang Ahmed Moledina Nayer Sikder CALL TO ORDER PUBLIC COMMUNICATION: GENERAL Nirali Thakkar, Vice-Chair Sarah Chen Zachary Dolling Hugh Li Alpha Shrestha Kuo Yang The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on April 22, 2026. DISCUSSION ITEMS 2. Discussion of Fiscal Year 2027 Priorities to inform future working groups. DISCUSSION AND ACTION ITEMS 3. 4. Approve a recommendation to Council for Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. Approve a recommendation to Council regarding funding for Communities in Schools. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison or TTY users’ route through 711. A person may request language access accommodations no later than 48 hours before the scheduled meeting. Please call or email Chelsea Pfeifer at the Austin City Clerk’s Office, at 512-974-2498 or chelsea.pfeifer@austintexas.gov to request service or for additional information. For more information on the Asian American Quality of Life Advisory Commission please contact Chelsea Pfeifer at 512-974-2498 or chelsea.pfeifer@austintexas.gov.
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, April 21, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, April 21, 2026, at 6310 Wilhelmina Delco Drive #1406, in Austin, Texas. Chair Sin called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Seonhye “Sonny” Sin, Chair Sarah Xiyi Chen Alpha Shrestha Nirali Thakkar COMMISSIONERS IN ATTENDANCE REMOTELY: Padmini Jambulapati, Vice Chair Aasiyah Baig Sarah Chen Zachary Dolling Hanna Huang Ahmed Moledina Nayer Sikder Kuo Yang PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission special called meeting on March 26, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on March 26, 2026 were approved on Commissioner Thakkar’s motion, Commissioner Xiyi Chen’s second on an 11-0 vote. Commissioner Yang was off the dais. Commissioner Li was absent. 1 DISCUSSION ITEMS 2. 3. 4. 5. 6. 7. 8. Presentation by Communities in Schools of Central Texas regarding the results of the economic mobility study and Communities in Schools of Central Texas programs. Presentation by Sharon Vigil, Chief Executive Officer, Communities in Schools of Central Texas. The presentation was made by Sharon Vigil, Chief Executive Officer, Communities in Schools of Central Texas. Presentation by Asian Family Support Services of Austin (AFSSA) regarding upcoming work during Sexual Assault Awareness Month and PARTners in Progress. Presentation by Bhumika Purohit, Systems Advocacy and Training Manager, AFSSA. Presented by Bhumika Purohit, Systems Advocacy and Training Manager, AFSSA and Commissioner Shrestha. Discussion on Austin Arts, Culture, Music, and Entertainment (AACME) recommendation for a Market Review of Job Titles. Discussed. Discussion of Budget Recommendation Advocacy led by the Budget working group. Discussed. Discussion on current workgroups, members, and progress status. Discussed. Discussion of new stakeholder positions. Discussed. Discussion on the priorities for the commission in the upcoming year. Discussed. DISCUSSION AND ACTION ITEMS 9. 10. Conduct officer elections for Chair. Commissioner Jambulapati was elected as Chair on Commissioner Thakkar’s motion, Commissioner Chen’s second on a 12-0 vote. Commissioner Li was absent. Conduct office elections for Vice Chair. Commissioner Thakkar was elected as Vice Chair on Commissioner Huang’s motion, Commissioner Shrestha’s second on a 12-0 vote. Commissioner Li was absent. FUTURE AGENDA ITEMS Update to membership of working groups Approve the nomination of …
. RECOMMENDATION TO COUNCIL Asian American Quality of Life Advisory Commission Recommendation Number [YYYYMMDD-XXX] : Recommendation to allocate $2 million to Communities In Schools of Central Texas for comprehensive integrated student support services and trauma-informed mental health services, early campus-based interventions WHEREAS, the City of Austin is committed to ensuring that race or language barrier no longer predicts a person's quality of life outcomes; and the 2025 Austin Travis County Community Health Assessment identifies increasing access to mental healthcare as a critical goal WHEREAS, there is a continued need for increased investment to support the growing mental health challenges faced by students in Austin area schools; WHEREAS, the Asian American Quality of Life Initiative identifies mental health services and successful educational outcomes as primary pillars for community success; and WHEREAS, students in the Austin area continue to face significant barriers to, including lack of access to culturally competent intensive mental health services; and WHEREAS, House Bill 6 (89th) seeks to increase access to mental health services in public schools while also placing new implications for student discipline in the classroom, focused on proactive approaches to addressing student needs; and WHEREAS, other recent legislative changes have placed new considerations on services offered to students through school systems when providing mental health services and supports; and WHEREAS, Communities In Schools of Central Texas provides critical "safety net" services through multiple programs, including their campus-based Integrated Student Supports, Care Coordination and wraparound services, and intensive mental health & wellness services for students; and WHEREAS, evidence-based services such as intensive mental health counseling provided by clinicians and social workers ensure students' unmet mental health needs are addressed through direct service to students and their families, with a family-centered, trauma-informed approach to connect students and their families to community resources; and WHEREAS, these mental health services have shown decreases in clinical scales of depression and/or anxiety for student symptoms and improved scores in post-test evaluation assessments; and WHEREAS, Results from a recently released Harvard-Cornell Study from Opportunity Insights and EdRedesign Lab showed that three years of involvement in Communities In Schools of Central Texas leads to significantly higher income earnings over a student’s lifetime, increased yearly tax contributions, less reliance on public assistance and significantly reduced involvement or . prevention of involvement in the criminal justice system and increased economic mobility leading to an increased tax base and stronger workforce. NOW, THEREFORE, BE IT RESOLVED …
ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, May 19, 2026 Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, May 19, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, May 19, 2026, at 4815 Mueller Blvd, Room 1125 in Austin, Texas. Chair Jambulapati called the Asian American Quality of Life Advisory Commission Meeting to order at 6:06 p.m. COMMISSIONERS IN ATTENDANCE: Padmini Jambulapati, Chair Nirali Thakkar, Vice Chair Zachary Dolling COMMISSIONERS IN ATTENDANCE REMOTELY: Alka Bhanot Sarah Chen Hugh Li Ahmed Moledina Alpha Shrestha Nayer Sikder Sarah Xiyi Chen Kuo Yang PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on April 22, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on April 22, 2026 were approved on Vice Chair Thakkar’s motion, Commissioner Moledina’s second on a 9-0 vote. Commissioners Yang and Li were off the dais. Commissioners Baig and Huang were absent. DISCUSSION ITEMS ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, May 19, 2026 3. Discussion of Fiscal Year 2027 Priorities to inform future working groups. Discussed. DISCUSSION AND ACTION ITEMS 3. 4. Approve a recommendation to Council for Austin Arts, Culture, Music and Entertainment Market Review of Job Titles. This item was withdrawn without objection. Approve a recommendation to Council regarding funding for Communities in Schools. This item was withdrawn without objection. FUTURE AGENDA ITEMS Recommendation to Council regarding ACME Market Review Recommendation to Council regarding Communities In Schools Staff Briefing from the APH Age-Friendly team on the recent study and ongoing engagement Staff Briefing from Austin Equity and Inclusion regarding the Levers of Economic Mobility Update Creation of Working Groups around recently discussed commission priorities Chair Jambulapati adjourned the meeting at 7:25 p.m. without objection. The minutes were approved at the June 16, 2026 meeting on Commissioner Moledina’s motion, Commissioner Huang’s second on an 8-0 vote. Commissioner Dolling was off the dais. Vice Chair Thakkar and Commissioners Baig, Bhanot, Li and Yang were absent. 2
REGULAR MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION TUESDAY, APRIL 21, 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406, 6310 WILHELMINA DELCO DR., AUSTIN, TEXAS Some members of the Asian American Quality of Life Commission may be participating by videoconference. The meeting may be viewed online at: http://www.austintexas.gov/page/watch- atxn-live Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Chelsea Pfeifer at chelsea.pfeifer@austintexas.gov or 512-974-2498. CURRENT COMMISSIONERS: Seonhye “Sonny” Sin, Chair Aasiyah Baig Sarah Xiyi Chen Hanna Huang Ahmed Moledina Nayer Sikder Kuo Yang CALL TO ORDER Padmini Jambulapati, Vice-Chair Sarah Chen Zachary Dolling Hugh Li Alpha Shrestha Nirali Thakkar PUBLIC COMMUNICATION: GENERAL The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission special called meeting on March 26, 2026. DISCUSSION ITEMS 2. Presentation by Communities in Schools of Central Texas regarding the results of the economic mobility study and Communities in Schools of Central Texas programs. Presentation by Sharon Vigil, Chief Executive Officer, Communities in Schools of Central Texas. 3. 4. 5. 6. 7. 8. Presentation by Asian Family Support Services of Austin (AFSSA) regarding upcoming work during Sexual Assault Awareness Month and PARTners in Progress. Presentation by Bhumika Purohit, Systems Advocacy and Training Manager, AFSSA. Discussion on Austin Arts, Culture, Music, and Entertainment (AACME) recommendation for a Market Review of Job Titles Discussion of Budget Recommendation Advocacy led by the Budget working group. Discussion on current workgroups, members, and progress status. Discussion of new stakeholder positions. Discussion on the priorities for the commission in the upcoming year. DISCUSSION AND ACTION ITEMS 9. 10. Conduct officer elections for Chair. Conduct officer elections for Vice Chair. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison or TTY users’ route through 711. A person …
Draft Meeting Minutes March 26, 2026 Asian American Quality of Life Advisory Commission Special Called Meeting Minutes Thursday, March 26, 2026 The Asian American Quality of Life Advisory Commission convened in a Special Called meeting on Thursday, March 26, at the Permitting and Development Center, Room #1406, Wilhelmina Drive in Austin, Texas. Chair Sin called the Special Called Asian American Quality of Life Advisory Commission Meeting to order at 6:06 p.m. COMMISSIONERS IN ATTENDANCE: Seonhye “Sonny” Sin, Chair Padmini Jambulapati, Vice Chair Sarah Xiyi Chen Hanna Huang COMMISSIONERS IN ATTENDANCE REMOTELY: Aasiyah Baig Sarah Chen Hugh Li Ahmed Moledina Alpha Shrestha Nayer Sikder Nirali Thakkar Kuo Yang PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on February 17, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on February 17, 2026 were approved on Commissioner Huang’s motion, Commissioner 1 Draft Meeting Minutes March 26, 2026 Chen’s second on an 11-0 vote. Commissioner Yang was off the dais. Commissioner Dolling was absent. STAFF BRIEFINGS 2. Staff Briefing regarding the Levers of Economic Mobility Index. Presentation by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion and Shivani Datar, Business Process Specialist, Austin Equity and Inclusion. The presentation was made by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion and Shivani Datar, Business Process Specialist, Austin Equity and Inclusion. WORKING GROUP UPDATE 3. Update from Asian American Quality of Life Advisory Commission Commissioner Search Working Group Update was given by Commissioner Huang. Stakeholder candidates were discussed. DISCUSSION AND ACTION ITEMS 4. Approve two stakeholder seats to the Asian American Quality of Life Advisory Commission. The motion to approve a stakeholder seat to Alka Bhanot was approved on Commissioner Huang’s motion, Commissioner Thakkar’s second on a 12-0 vote. Commissioner Dolling was absent. The motion to approve a stakeholder seat to Bhumika Purohit was approved on Commissioner Shrestha’s motion, Commissioner Huang’s second on a 12-0 vote. Commissioner Dolling was absent. 5. Approve a Budget Recommendation to Council regarding the Quality-of-Life study. The following amendment was made by Commissioner Huang and seconded by Commissioner Xiyi Chen. The amendment was to insert the following: “Without updated, disaggregated data, Asian American communities remain underrepresented in City decision-making and program design. The UT Austin School of Social Work is currently working on an updated pilot …
EST. 1992 ASIAN FAMILY SUPPORT SERVICES OF AUSTIN EVERY AFSSA CLIENT IS A CLIENT FOR LIFE We support survivors of domestic violence, sexual assault & trafficking throughout Central Texas with free, confidential services 877-281-837124/7 HOTLINE AVAILABLE IN ANY LANGUAGE OUR MISSION Promote abuse-free Asian and immigrant communities through advocacy, support, awareness, and access to social services OUR HISTORY 1992 Founded as Saheli by community members 2004 2019 Saheli was an all-volunteer organization until 2004, when it received funding for two paid staff members Meeting and Collaborating with other Domestic Violence and Sexual Assault Agencies to talk about regional and statewide issues 2025 Celebrated our 33th Anniversary DEMOGRAPHICS 692 In 2025, we used 28 languages for service delivery, and 25%of our services were delivered in a non-English language.Here are the langauges we used for service delivery in 2025,and the ones in bold are langauges our staff speakAmharicArabicBurmeseCantoneseDariEnglishFarsiFrenchFrench CanadianFrench CreoleHindiJapaneseKoreanMandarinNepaliPashtoPersianPortegueseSpanishTagalogTamilThaiTigrinyaTurkishRussianUrduVietnamese OUR IMPACT COMMUNITY EDUCATION 323 Events attended or produced in 2025 OUR SERVICES Help finding medical care, legal representation & immigration help Help finding emergency shelter & long term housing Crisis intervention & safety planning Basic needs like groceries, diapers & formula Group & individual counseling, peer support programs English classes, job search help & education opportunities 8 7 7 - 2 8 1 - 8 3 7 1 24-HOUR HOTLINE AVAILABLE IN ANY LANGUAGE OUR IMPACT COMMUNITY TRAINING AFSSA also provides community outreach & training to workplaces, law enforcement, faith groups, youth programs, and more! STALKING AWARENESS AND INTERVENTION ONLINE SAFETY HEALTHY RELATIONSHIPS WORKING WITH INTERPRETERS MARGINS TO CENTER BARRIERS FOR ASIAN AND IMMIGRANT SURVIVORS OF VIOLENCE One-day gathering dedicated to healing, community connection, and collective action. Rooted in ancestral wisdom and community care, the summit invites participants to explore pathways toward self-determination and healthier relationships. SATURDAY, APRIL 25TH, 2026 FROM 9AM - 4PM PERMITTING + DEVELOPMENT CENTER Here’s a sneak peak...Here’s a sneak peak...Here’s a sneak peak...The Interplay Between SubstanceUse And Interpersonal Violence Mutual Aid as a ProtectiveFactor Against ViolenceBuilding our capacity for resistance:Why the work for liberation beginswith tending to our rootsYou Are Your Own Magic:Tarot for Self EmpowermentPARTners inProgressRegister here: Please fill out this evaluation form! 24/7 Hotline 877-281-8371 AFSSAustin.org @AFSSAustin Bhumika Purohit Manager of Systems Advocacy & Training POINTS OF CONTACTBPUROHIT@AFSSAUSTIN.ORG
Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, April 21, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, April 21, 2026, at 6310 Wilhelmina Delco Drive #1406, in Austin, Texas. Chair Sin called the Asian American Quality of Life Advisory Commission Meeting to order at 6:05 p.m. COMMISSIONERS IN ATTENDANCE: Seonhye “Sonny” Sin, Chair Sarah Xiyi Chen Alpha Shrestha Nirali Thakkar COMMISSIONERS IN ATTENDANCE REMOTELY: Padmini Jambulapati, Vice Chair Aasiyah Baig Sarah Chen Zachary Dolling Hanna Huang Ahmed Moledina Nayer Sikder Kuo Yang PUBLIC COMMUNICATION: GENERAL None present. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission special called meeting on March 26, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on March 26, 2026 were approved on Commissioner Thakkar’s motion, Commissioner Xiyi Chen’s second on an 11-0 vote. Commissioner Yang was off the dais. Commissioner Li was absent. 1 DISCUSSION ITEMS 2. 3. 4. 5. 6. 7. 8. Presentation by Communities in Schools of Central Texas regarding the results of the economic mobility study and Communities in Schools of Central Texas programs. Presentation by Sharon Vigil, Chief Executive Officer, Communities in Schools of Central Texas. The presentation was made by Sharon Vigil, Chief Executive Officer, Communities in Schools of Central Texas. Presentation by Asian Family Support Services of Austin (AFSSA) regarding upcoming work during Sexual Assault Awareness Month and PARTners in Progress. Presentation by Bhumika Purohit, Systems Advocacy and Training Manager, AFSSA. Presented by Bhumika Purohit, Systems Advocacy and Training Manager, AFSSA and Commissioner Shrestha. Discussion on Austin Arts, Culture, Music, and Entertainment (AACME) recommendation for a Market Review of Job Titles. Discussed. Discussion of Budget Recommendation Advocacy led by the Budget working group. Discussed. Discussion on current workgroups, members, and progress status. Discussed. Discussion of new stakeholder positions. Discussed. Discussion on the priorities for the commission in the upcoming year. Discussed. DISCUSSION AND ACTION ITEMS 9. 10. Conduct officer elections for Chair. Commissioner Jambulapati was elected as Chair on Commissioner Thakkar’s motion, Commissioner Chen’s second on a 12-0 vote. Commissioner Li was absent. Conduct office elections for Vice Chair. Commissioner Thakkar was elected as Vice Chair on Commissioner Huang’s motion, Commissioner Shrestha’s second on a 12-0 vote. Commissioner Li was absent. FUTURE AGENDA ITEMS Update to membership of working groups Approve the nomination of …
SPECIAL CALLED MEETING OF THE ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION THURSDAY, MARCH 26, 2026, AT 6:00 PM PERMITTING AND DEVELOPMENT CENTER, ROOM 1406 6310 WILHELMINA DELCO DRIVE AUSTIN, TEXAS Some members of the Asian American Quality of Life Advisory Commission may be participating by videoconference. Public comment will be allowed in-person or remotely via telephone. Speakers may only register to speak on an item once either in-person or remotely and will be allowed up to three minutes to provide their comments. Registration no later than noon the day before the meeting is required for remote participation by telephone. To register to speak remotely, contact Nekaybaw Watson, 512-974-2562, nekaybaw.watson@austintexas.gov. CURRENT COMMISSIONERS: Seonhye “Sonny” Sin, Chair Sarah Chen Zachary Dolling Hugh Li Alpha Shrestha Nirali Thakkar CALL TO ORDER PUBLIC COMMUNICATION: GENERAL Padmini Jambulapati, Vice-Chair Sarah Xiyi Chen Hanna Huang Ahmed Moledina Nayer Sikder Kuo Yang AGENDA The first ten speakers signed up prior to the meeting being called to order will each be allowed a three-minute allotment to address their concerns regarding items not posted on the agenda. APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on February 17, 2026. STAFF BRIEFING 2. Staff Briefing regarding the Levers of Economic Mobility Index. Presentation by Gary Aaron, Business Process Consultant Sr., Austin Equity and Inclusion and Shivani Datar, Business Process Specialist, Austin Equity and Inclusion. WORKING GROUP UPDATE 3. Update from Asian American Quality of Life Advisory Commission Commissioner Search Working Group DISCUSSION AND ACTION ITEMS 4. Approve two stakeholder seats to the Asian American Quality of Life Advisory Commission. 5. Approve a Budget Recommendation to Council regarding the Quality-of-Life study. 6. Approve a Budget Recommendation to Council regarding Asian American Resource Center (AARC) staffing. 7. Approve a budget recommendation to Council regarding unmet needs of the Asian American Resource Center. 8. Approve a Budget Recommendation to Council regarding Austin Public Health (APH) Immigration legal services. 9. Approve a Budget Recommendation to Council regarding APH social services and community health navigator positions. 10. Approve a Budget Recommendation to Council regarding Historic Preservation 11. Approve a Proclamation for Asian American and Pacific Islander Heritage Month. FUTURE AGENDA ITEMS ADJOURNMENT The City of Austin is committed to compliance with the Americans with Disabilities Act. Reasonable modifications and equal access to communications will be provided upon request. For assistance, please contact the Liaison …
ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, February 17, 2026 Asian American Quality of Life Advisory Commission Regular Meeting Minutes Tuesday, February 17, 2026 The Asian American Quality of Life Advisory Commission convened in a regular meeting on Tuesday, February 17, 2026, at Austin Energy Headquarters, Room 1125, 4815 Mueller Blvd. in Austin, Texas. Chair Sin called the Asian American Quality of Life Advisory Commission Meeting to order at 6:07 p.m. COMMISSIONERS IN ATTENDANCE: Seonhye “Sonny” Sin, Chair Padmini Jambulapati, Vice Chair Sarah Chen Nirali Thakkar COMMISSIONERS IN ATTENDANCE REMOTELY: Hanna Huang Ahmed Moledina Nayer Sikder Zachary Dolling PUBLIC COMMUNICATION: GENERAL Hector Ordaz- Cultural Arts Funding/ACME/Creative Reset APPROVAL OF MINUTES 1. Approve the minutes of the Asian American Quality of Life Advisory Commission regular meeting on January 20, 2026. The minutes from the Asian American Quality of Life Advisory Commission regular meeting on January 20, 2026 were approved on Commissioner Chen’s motion, Vice Chair Padmini’s second on an 8-0 vote. Commissioners Xiyi Chen, Li, Shrestha and Yang were absent. STAFF BRIEFINGS 2. Staff briefing regarding We All Belong Campaign updates and upcoming programming. Presentation by Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. 1 ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION MEETING MINUTES Tuesday, February 17, 2026 The presentation was made by Shafina Khaki, Human Rights Officer, Austin Equity and Inclusion. DISCUSSION ITEMS 3. 4. 5. Presentation by American Gateways regarding successes with the City of Austin and a request for the Prioritization of immigration funding in the FY 26-27 budget. Presentation by Edna Yang, Co-Executive Director, American Gateways. The presentation was made by Edna Yang, Co-Executive Director, American Gateways. Discussion regarding the creation of a proclamation for Asian American and Pacific Islander Heritage Month. Discussed. Discussion regarding the Commissioner and Stakeholder Search Community Working Group outreach plan. Discussed. WORKING GROUP UPDATES 6. 7. Update from the Asian American Resource Center Working Group regarding the AARC’s Capital Improvement Projects. The update was given by Commissioner Huang. Update from the Joint Inclusion Committee Working Group regarding the budget impacts for community organizations, collaborating across commissions for budget updates, and other budget considerations informed by Austin Equity and Inclusion and Austin Police. The update was given by Commissioner Huang and Commissioner Thakkar. DISCUSSION AND ACTION ITEMS 8. Approve a meeting date change to the March meeting. The motion to approve a meeting date change to the March meeting …
Economic Mobility Austin Equity & Inclusion Our Time Together • Economic Mobility Overview • Quality-of-Life Studies: Key Connections • Building the Economic Mobility Index • Turning the Index Into Action • Upcoming Event 2 What Drives Economic Mobility Economic mobility is shaped by our systems, policies, and investments — not just individual effort. Mobility includes building wealth and long-term stability for future generations. Education, health, housing, childcare, and strong social conditions enable families to thrive. In Austin, persistent disparities limit opportunities, but a person’s future shouldn’t be determined by their neighborhood or systemic barriers. Beyond Wages Quality of Life We Shape Systems 3 Quality-of-Life Studies: Key Connections High-Level Themes Financial Progress & Economic Outcomes • Deeply affordable housing • • Utility assistance and energy relief Job pipelines and employment access programs Quality of Life & Well-Being • Pop-up clinics in high-need areas • Culturally competent healthcare training Inclusive planning processes for older • adults Opportunities & Access Teen job search portal • • Strengthen multilingual outreach • Partnerships with schools, nonprofits, and public agencies Families, Communities, & Systems • Neighborhood safety audits • Greening and beautification initiatives • Strengthen family-support systems through childcare access and wraparound services 4 Definition Economic mobility addresses systems to improve unfair conditions that influence whether individuals, families, and communities can prosper over time and across generations. It means access to opportunities and resources needed for basic needs, financial security, and a dignified, high quality of life — regardless of race, place, gender, or ability. 5 Economic Mobility Index Human-centered, place-based tool for understanding conditions that shape residents’ ability to thrive in Austin. Visualizes neighborhood- level disparities as defined by economic mobility. Focuses on underlying conditions to guide service delivery and decision- making using data and community insights. Provides a common lens to support coordination, planning, and shared outcomes—without replacing existing tools. 6 Our Approach: Identifying Levers National Frameworks & Local Tools • Drivers of Poverty • Social Vulnerable Index • Justice 40 • Neighborhood Prosperity Dashboard etc. Hybrid Engagement Process • Quality of Life Studies • CoA Commissions • Internal & External Stakeholders • Every Texan Peer Cities Review 10 cities similar in: • State • Size • Demographics • Product CoA Levers of Economic Mobility • 3 Themes • 6 Sub-themes • 18 Levers of Economic Mobility 7 Building the Index Together Early childhood foundations shape mobility • Indicator: Enrollment in early education (public …
RECOMMENDATION TO COUNCIL ASIAN AMERICAN QUALITY OF LIFE ADVISORY COMMISSION Recommendation Number: [YYYYMMDD-XXX]: Funding to Conduct an Updated Asian American Quality of Life Study Date of Approval: _____________ Recommendation: The Asian American Quality-of-Life Advisory Commission recommends that the City of Austin allocate $200,000 in the FY 2027 budget to conduct an updated Asian American Quality of Life Study. Description of Recommendation to Council: Austin’s demographics have changed. The data guiding City decisions has not. This funding would support: • Survey design, administration, and data analysis • Participant incentives to ensure representative participation • Community outreach and engagement • Reporting and presentations to City departments and advisory bodies This investment accounts for population growth, inflation, and improved data collection methods compared to the 2014 study. Rationale: The City’s most recent Asian American Quality of Life Study was completed in 2016, using data collected in 2014. That data is now outdated and no longer reflects Austin’s current demographics. Asian Americans are among the fastest-growing populations in Austin, with significant changes in population size, geographic distribution, languages spoken, housing conditions, economic stability, and health needs—particularly following COVID-19. Despite this growth, City departments continue to report limited and incomplete data on Asian American residents, making equitable planning and service delivery difficult. Without updated, disaggregated data, Asian American communities remain underrepresented in City decision-making and program design. The updated study would: RECOMMENDATION TO COUNCIL • Reflect current demographic and population changes • Provide disaggregated data across Asian ethnic groups, age, language, and neighborhood Identify gaps in access to health, housing, economic, and City services • • Support data-driven planning and equitable service delivery across City departments The study will result in a public report and actionable findings for City use. Seconded By: Motioned By: Vote: For: Against: Abstain: Off the dais: Absent: Attest: __________________________________
